Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
TV3_ori

PKB-number: PKB366
Definition: 5\'-terminal region
Organism: Turdivirus 3
Abbreviation: TV3_ori
RNA type: Viral 5 UTR
Keywords: Picornaviridae; IRES
EMBL number: GU182410
Submitted by: A.P. Gultyaev (a.p.gultyaev@biology.leidenuniv.nl)
Supported by: Sequence comparison
References: [1] Sweeney TR et al. (2012). J. Virol. 86:1468-1486.
Stem sizes:
Loop sizes:
5 5
2 0 46
Position Paired:
43 -47 ; 55 -59 
67 -72 ; 95 -100
74 -81 ; 86 -93
50 -54 ; 106-110
Bracket view of structure:
             50        60        70        80        90       100
#    123456789|123456789|123456789|123456789|123456789|123456789|
$ 41 UCCGUCCAAGCCGCGGACGUUAAACUGUGGCACGGUUGUGCCUAGGUGCAACCCUGCUAC=100
% 41 ::(((((::[[[[[))))):::::::((((((:((((((((::::)))))))):))))))

             110       120
#     123456789|123456789|
$ 101 UAAUGGCGGUACCCCUGCCC=120
% 101 :::::]]]]]::::::::::


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2012-9-9 PKB00366.HTML