Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
IAV_PK_M

PKB-number: PKB367
Definition: Pseudoknot at the 3\' splice site of M gene of influenza A virus
Organism: influenza A virus
Abbreviation: IAV_PK_M
RNA type: Viral others
Keywords: Orthomyxoviridae; influenza virus
EMBL number: CY014592
Submitted by: A.P. Gultyaev (a.p.gultyaev@biology.leidenuniv.nl)
Supported by: Mutagenesis,Sequence comparison,Structure probing
References: [1] Moss WN et al. (2012). PLoS One 7(6):e38323.
Stem sizes:
Loop sizes:
4 7
21 0 19
Position Paired:
707-710; 739-742
714-717; 724-727
743-743; 760-760
745-747; 756-758
732-738; 762-768
Bracket view of structure:
       710       720       730       740       750       760       770
#     789|123456789|123456789|123456789|123456789|123456789|123456789|
$ 707 GGCCUAAAAGAUGAUCUUCUUGAAAAUUUGCAGGCCUACCAGAAACGGAUGGGAGUGCAGAUGC=770
% 707 ((((:::((((::::::))))::::[[[[[[[))))(:(((::::::::))):):]]]]]]]::


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2012-9-9 PKB00367.HTML