Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
TPAV_psiA

PKB-number: PKB368
Definition: Pseudoknot psiA in the 3'UTR of Thin paspalum asymptomatic virus
Organism: Thin paspalum asymptomatic virus strain 2005
Abbreviation: TPAV_psiA
RNA type: Viral 3 UTR
Keywords: Tombusviridae; Panicovirus
EMBL number: JX848617
Submitted by: A.P. Gultyaev (a.p.goultiaev@liacs.leidenuniv.nl)
Supported by: Sequence comparison
References: [1] Scheets K. (2013). Virus Research 176:161-168.
Comment: Similar pseudoknots in Panicum mosaic virus (PMV) and Cocksfoot mild mosaic virus (CMMV) [1]
Stem sizes:
Loop sizes:
4 5
1 0 7
Position Paired:
3890-3893; 3900-3903
3895-3899; 3911-3915
Bracket view of structure:
     3890      3900      3910
#      9|123456789|123456789|123456
$ 3889 AGGCUAGGACCGGCCAGACAAAGGUCCG=3916
% 3889 :((((:[[[[[)))):::::::]]]]]:


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2014-9-17 PKB00368.HTML