Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
PMV_psiA

PKB-number: PKB369
Definition: Pseudoknot psiA in the 3'UTR of Panicum mosaic virus
Organism: Panicum mosaic virus
Abbreviation: PMV_psiA
RNA type: Viral 3 UTR
Keywords: Tombusviridae; Panicovirus
EMBL number: NC_002598
Submitted by: A.P. Gultyaev (a.p.goultiaev@liacs.leidenuniv.nl)
Supported by: Sequence comparison
References: [1] Scheets K. (2013). Virus Research 176:161-168.
Comment: Similar pseudoknots in Thin paspalum asymptomatic virus (TPAV) and Cocksfoot mild mosaic virus (CMMV) [1]
Stem sizes:
Loop sizes:
6 5
1 0 5
Position Paired:
4019-4024; 4031-4036
4026-4030; 4042-4046
Bracket view of structure:
      4020      4030      4040
#      89|123456789|123456789|1234567
$ 4018 ACAGGCUAGGACCGGCCUGAUAAAGGUCCG=4047
% 4018 :((((((:[[[[[)))))):::::]]]]]:


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2014-9-17 PKB00369.HTML