Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
PMV_psiB

PKB-number: PKB370
Definition: Pseudoknot psiB in the 3'UTR of Panicum mosaic virus
Organism: Panicum mosaic virus
Abbreviation: PMV_psiB
RNA type: Viral 3 UTR
Keywords: Tombusviridae; Panicovirus
EMBL number: NC_002598
Submitted by: A.P. Gultyaev (a.p.goultiaev@liacs.leidenuniv.nl)
Supported by: Sequence comparison
References: [1] Scheets K. (2013). Virus Research 176:161-168.
Comment: Similar pseudoknots in Thin paspalum asymptomatic virus (TPAV) and Cocksfoot mild mosaic virus (CMMV) [1].
Stem sizes:
Loop sizes:
7 6
1 3 6
Position Paired:
4052-4058; 4069-4075
4060-4065; 4082-4087
Bracket view of structure:
             4060      4070      4080
#      123456789|123456789|123456789|12345678
$ 4051 UGAUGUGCAGCUUCUUAGGUGCAUCUCGUAUAGAAGCG=4088
% 4051 :(((((((:[[[[[[:::)))))))::::::]]]]]]:


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2014-9-17 PKB00370.HTML