Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
CMMV_psiA

PKB-number: PKB371
Definition: Pseudoknot psiA in the 3'UTR of Cocksfoot mild mosaic virus
Organism: Cocksfoot mild mosaic virus
Abbreviation: CMMV_psiA
RNA type: Viral 3 UTR
Keywords: Tombusviridae; Panicovirus
EMBL number: NC_011108
Submitted by: A.P. Gultyaev (a.p.goultiaev@liacs.leidenuniv.nl)
Supported by: Sequence comparison
References: [1] Scheets K. (2013). Virus Research 176:161-168.
Comment: Similar pseudoknots in Thin paspalum asymptomatic virus (TPAV) and Panicum mosaic virus (PMV) [1]
Stem sizes:
Loop sizes:
5 5
1 0 8
Position Paired:
3887-3891; 3898-3902
3893-3897; 3911-3915
Bracket view of structure:
        3890      3900      3910
#      6789|123456789|123456789|123456
$ 3886 GAGGUUAGAGUCGACCUGUUAAACAGACUCA=3916
% 3886 :(((((:[[[[[)))))::::::::]]]]]:


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2014-9-17 PKB00371.HTML