Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
CMMV_psiB

PKB-number: PKB372
Definition: Pseudoknot psiB in the 3'UTR of Cocksfoot mild mosaic virus
Organism: Cocksfoot mild mosaic virus
Abbreviation: CMMV_psiB
RNA type: Viral 3 UTR
Keywords: Tombusviridae; Panicovirus
EMBL number: NC_011108
Submitted by: A.P. Gultyaev (a.p.goultiaev@liacs.leidenuniv.nl)
Supported by: Sequence comparison
References: [1] Scheets K. (2013). Virus Research 176:161-168.
Comment: Similar pseudoknots in Thin paspalum asymptomatic virus (TPAV) and Panicum mosaic virus (PMV) [1].
Stem sizes:
Loop sizes:
7 3
1 5 11
Position Paired:
3920-3926; 3936-3942
3928-3930; 3954-3956
Bracket view of structure:
       3920      3930      3940      3950
#      789|123456789|123456789|123456789|1234567
$ 3917 CCUCGGGCACGCGCUGAAAGUGCCCGUUGGAAGGAUUGCGA=3957
% 3917 :::(((((((:[[[:::::))))))):::::::::::]]]:


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2014-9-17 PKB00372.HTML