Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
CCR5_PRF

PKB-number: PKB373
Definition: CCR5 mRNA frameshifting pseudoknot
Organism: Homo sapiens
Abbreviation: CCR5_PRF
RNA type: mRNA
Keywords: CCR5; cytokine receptor; HIV-1
EMBL number: NM_000579
Submitted by: A.P. Gultyaev (a.p.goultiaev@liacs.leidenuniv.nl)
Supported by: Sequence comparison,Structure probing,Molecular modelling; programmed -1 ribosomal frameshift (PRF)
References: [1] Belew A.T. et al. (2014) Nature 512:265-269.
Stem sizes:
Loop sizes:
13 25
1 1 0
Position Paired:
772-773; 838-839
776-777; 836-837
778-786; 819-827
788-793; 862-867
794-799; 854-859
802-803; 852-853
805-809; 847-851
812-817; 840-845
Bracket view of structure:
         770       780       790       800       810       820
#     56789|123456789|123456789|123456789|123456789|123456789|123456789
$ 765 UUUAAAAGCCAGGACGGUCACCUUUGGGGUGGUGACAAGUGUGAUCACUUGGGUGGUGGCUGUGU=829
% 765 :::::::((::(((((((((((:[[[[[[[[[[[[::[[:[[[[[::[[[[[[:)))))))))

    830       840       850       860
#     |123456789|123456789|123456789|1234567
$ 830 UUGCGUCUCUCCCAGGAAUCAUCUUUACCAGAUCUCAA=867
% 830 ::::::))))]]]]]]:]]]]]]]]]]]]]::]]]]]]


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2014-9-17 PKB00373.HTML