Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
Ec_RydC

PKB-number: PKB374
Definition: RydC sRNA pseudoknot of Escherichia coli
Organism: Escherichia coli K-12
Abbreviation: Ec_RydC
RNA type: Others
Keywords: small RNA (sRNA); biofilm production; translation inhibition; antisense RNA
EMBL number: NC_000913
Submitted by: A.P. Gultyaev (a.p.goultiaev@liacs.leidenuniv.nl)
Supported by: Mutagenesis,Sequence comparison,Structure probing
References: [1] Antal M. et al. (2005) J. Biol. Chem. 280:7901-7908.
[2] Bordeau V. & Felden B. (2014). Nucleic Acids Res. 42:4682-4696.
Comment: The shown region corresponds to the complement (1491443..1491506) from NCBI Reference Sequence NC_000913.
Stem sizes:
Loop sizes:
7 9
6 1 7
Position Paired:
12-18; 35-41
25-33; 49-57
Bracket view of structure:
            10        20        30        40        50        60
#   123456789|123456789|123456789|123456789|123456789|123456789|1234
$ 1 CUUCCGAUGUAGACCCGUAUUCUUCGCCUGUACCACGGGUCGGUUUUAGUACAGGCGUUUUCUU=64
% 1 :::::::::::(((((((::::::[[[[[[[[[:))))))):::::::]]]]]]]]]:::::::


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2014-9-17 PKB00374.HTML