Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
TPAV_psiB

PKB-number: PKB375
Definition: Pseudoknot psiB in the 3'UTR of Thin paspalum asymptomatic virus
Organism: Thin paspalum asymptomatic virus strain 2005
Abbreviation: TPAV_psiB
RNA type: Viral 3 UTR
Keywords: Tombusviridae; Panicovirus
EMBL number: JX848617
Submitted by: A.P. Gultyaev (a.p.goultiaev@liacs.leidenuniv.nl)
Supported by: Sequence comparison
References: [1] Scheets K. (2013). Virus Research 176:161-168.
Comment: Similar pseudoknots in Panicum mosaic virus (PMV) and Cocksfoot mild mosaic virus (CMMV) [1]
Stem sizes:
Loop sizes:
10 5
1 4 6
Position Paired:
3918-3927; 3938-3947
3929-3933; 3954-3958
Bracket view of structure:
       3920      3930      3940      3950      3960
#      789|123456789|123456789|123456789|123456789|
$ 3917 ACACUACAUGCAGCGCUCUAGGUGUGUAGUGACAGUAAGCGCGC=3960
% 3917 :((((((((((:[[[[[::::))))))))))::::::]]]]]::


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2014-9-17 PKB00375.HTML