Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
IAV_PK_NP

PKB-number: PKB376
Definition: Pseudoknot in the NP vRNA of influenza A virus
Organism: influenza A virus, strain A/PR/8/34
Abbreviation: IAV_PK_NP
RNA type: Viral others
Keywords: Orthomyxoviridae; influenza virus
EMBL number: EF467822
Submitted by: A.P. Gultyaev (a.p.goultiaev@liacs.leidenuniv.nl)
Supported by: Mutagenesis,Sequence comparison
References: [1] Gultyaev A.P. et al. (2014). RNA Biol. 11:942-952.
Comment: The numbering is given for negative-sense vRNA, complementary to the sequence provided by the nucleotide sequence database. Similar pseudoknots are formed in other strains of influenza A virus [1].
Stem sizes:
Loop sizes:
6 7
1 0 12
Position Paired:
91 -94 ; 108-111
95 -96 ; 105-106
98 -104; 124-130
Bracket view of structure:
            100       110       120       130
#    123456789|123456789|123456789|123456789|1
$ 91 GGCACGAUCGGGCUCGCUGCCUUUUCGUCCGAGAGCUCGAA=131
% 91 ((((((:[[[[[[[)):))))::::::::::::]]]]]]]:


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2014-11-26 PKB00376.HTML