Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
Ad2_VA_RNAI

PKB-number: PKB377
Definition: Central domain pseudoknot in the adenoviral VA RNAI
Organism: Adenovirus type 2
Abbreviation: Ad2_VA_RNAI
RNA type: Viral others
Keywords: adenovirus; virus-associated RNA; ncRNA
EMBL number: M10228
Submitted by: A.P. Gultyaev (a.p.goultiaev@liacs.leidenuniv.nl)
Supported by: Mutagenesis,Structure probing
References: [1] Ma Y. & Mathews M.B. (1996). RNA 2:937-955.
[2] Wilson J.L. et al. (2014). J. Biol. Chem. 289:23233-23245.
Stem sizes:
Loop sizes:
11 2
3 2 1
Position Paired:
41 -45 ; 138-142
47 -50 ; 129-132
52 -63 ; 90 -101
65 -69 ; 84 -88
71 -72 ; 81 -82
104-110; 118-124
114-115; 134-135
Bracket view of structure:
             50        60        70        80        90       100
#    123456789|123456789|123456789|123456789|123456789|123456789|
$ 41 UCGCAAGGGUAUCAUGGCGGACGACCGGGGUUCGAACCCCGGAUCCGGCCGUCCGCCGUG=100
% 41 (((((:((((:((((((((((((:(((((:((::::::::)):))))):)))))))))))

             110       120       130       140
#     123456789|123456789|123456789|123456789|12
$ 101 AUCCAUGCGGUUACCGCCCGCGUGUCGAACCCAGGUGUGCGA=142
% 101 )::(((((((:::[[::)))))))::::)))):]]::)))))


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2014-11-26 PKB00377.HTML