Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
ydaO_riboswitch_Tt

PKB-number: PKB378
Definition: ydaO riboswitch
Organism: Thermoanaerobacter tengcongensis
Abbreviation: ydaO_riboswitch_Tt
RNA type: Aptamers
Keywords: ydaO; riboswitch; c-di-AMP
EMBL number: 4QLM_A
Submitted by: A.P. Gultyaev (a.p.goultiaev@liacs.leidenuniv.nl)
Supported by: Crystal structure,Mutagenesis,Sequence comparison
References: [1] Ren A. & Patel D.J. (2014). Nature Chem. Biol. 10:780-786.
Comment: The ydaO riboswitch motif is common in bacteria.
Stem sizes:
Loop sizes:
25 7
1 0 3
Position Paired:
5  -9  ; 107-111
22 -28 ; 100-106
32 -32 ; 96 -96
39 -39 ; 94 -94
40 -44 ; 87 -91
47 -54 ; 59 -66
67 -72 ; 81 -86
74 -80 ; 115-121
Bracket view of structure:
            10        20        30        40        50        60        70
#   123456789|123456789|123456789|123456789|123456789|123456789|123456789|
$ 1 GGAUCGCUGAACCCGAAAGGGGCGGGGGACCCAGAAAUGGGGCGAAUCUCUUCCGAAAGGAAGAGUAGGG=70
% 1 ::::(((((::::::::::::(((((((:::(::::::((((((::((((((((::::))))))))((((

             80        90       100       110       120
#    123456789|123456789|123456789|123456789|123456789|123
$ 71 UUACUCCUUCGACCCGAGCCCGUCAGCUAACCUCGCAAGCGUCCGAAGGAGAA=123
% 71 ((:[[[[[[[)))))))))))::):):::)))))))))))):::]]]]]]]::


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2014-11-26 PKB00378.HTML