Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
ydaO_riboswitch_Tp

PKB-number: PKB379
Definition: ydaO riboswitch
Organism: Thermoanaerobacter pseudethanolicus
Abbreviation: ydaO_riboswitch_Tp
RNA type: Aptamers
Keywords: ydaO; riboswitch; c-di-AMP
EMBL number: 4QK8_A
Submitted by: A.P. Gultyaev (a.p.goultiaev@liacs.leidenuniv.nl)
Supported by: Crystal structure,Mutagenesis,Sequence comparison
References: [1] Gao A. & Serganov A. (2014) Nature Chem. Biol. 10:787-792.
Comment: The ydaO riboswitch motif is common in bacteria.
Stem sizes:
Loop sizes:
26 6
1 0 5
Position Paired:
4  -8  ; 105-109
11 -13 ; 18 -20
21 -27 ; 98 -104
30 -31 ; 94 -95
39 -44 ; 85 -90
47 -53 ; 59 -65
66 -71 ; 79 -84
73 -78 ; 115-120
Bracket view of structure:
            10        20        30        40        50        60        70
#   123456789|123456789|123456789|123456789|123456789|123456789|123456789|
$ 1 GGUUGCCGAAUCCGAAAGGUACGGAGGAACCGCUUUUUGGGGUUAAUCUGCAGUGAAGCUGCAGUAGGGA=70
% 1 :::(((((::(((::::)))(((((((::((:::::::((((((::(((((((:::::)))))))(((((

             80        90       100       110       120
#    123456789|123456789|123456789|123456789|123456789|12
$ 71 UACCUUCUGUCCCGCACCCGACAGCUAACUCCGGAGGCAAUAAAGGAAGGAG=122
% 71 (:[[[[[[)))))))))))):::))::)))))))))))):::::]]]]]]::


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2014-11-26 PKB00379.HTML