Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
ydaO_riboswitch_Tl

PKB-number: PKB380
Definition: ydaO riboswitch
Organism: Thermovirga lienii
Abbreviation: ydaO_riboswitch_Tl
RNA type: Aptamers
Keywords: ydaO; riboswitch; c-di-AMP
EMBL number: 4QK9_A
Submitted by: A.P. Gultyaev (a.p.goultiaev@liacs.leidenuniv.nl)
Supported by: Crystal structure,Mutagenesis,Sequence comparison
References: [1] Gao A. & Serganov A. (2014) Nature Chem. Biol. 10:787-792.
Comment: The ydaO riboswitch motif is common in bacteria.
Stem sizes:
Loop sizes:
26 7
3 0 2
Position Paired:
3  -7  ; 109-113
10 -14 ; 19 -23
24 -30 ; 102-108
33 -34 ; 98 -99
43 -43 ; 96 -96
44 -48 ; 89 -93
51 -56 ; 61 -66
67 -72 ; 83 -88
76 -82 ; 116-122
Bracket view of structure:
            10        20        30        40        50        60        70
#   123456789|123456789|123456789|123456789|123456789|123456789|123456789|12345
$ 1 GGCGCUGAAUUCCCUGAAGGGAAACGGGGGACCCAAUCUUCAGGGGUGAAUCCCACGUAAGUGGGUAGGGCUAGU=75
% 1 ::(((((::(((((::::)))))(((((((::((::::::::((((((::((((((::::))))))((((((:::

        80        90       100       110       120
#    6789|123456789|123456789|123456789|123456789|1234
$ 76 CUCUUUCGGCCCGAACCCGUCAGCUAACCUCGUAAGCGUGGAAAGAGGG=124
% 76 [[[[[[[)))))))))))::):))::))))))))))))::]]]]]]]::


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2014-11-26 PKB00380.HTML