Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
ydaO_riboswitch_Bs

PKB-number: PKB381
Definition: ydaO riboswitch
Organism: Bacillus subtilis
Abbreviation: ydaO_riboswitch_Bs
RNA type: Aptamers
Keywords: ydaO; riboswitch; c-di-AMP
EMBL number: CP009796
Submitted by: A.P. Gultyaev (a.p.goultiaev@liacs.leidenuniv.nl)
Supported by: Crystal structure,Sequence comparison
References: [1] Block K.F. et al. (2010). J. Bacteriol. 192:3983-3989.
[2] Nelson JW et al. Nature Chem. Biol. 2013 9:834-839.
[3] Gao A. & Serganov A. (2014). Nature Chem. Biol. 10:787-792.
Comment: The ydaO riboswitch motif is common in bacteria. The sequence given here corresponds to the region 444631-444770 of complete genome of Bacillus subtilis strain SG6 (Accession CP009796.1)
Stem sizes:
Loop sizes:
27 6
3 3 2
Position Paired:
8  -9  ; 130-131
11 -15 ; 125-129
18 -21 ; 26 -29
30 -36 ; 118-124
39 -40 ; 114-115
46 -51 ; 57 -62
63 -63 ; 112-112
64 -68 ; 105-109
71 -74 ; 79 -82
83 -87 ; 100-104
91 -96 ; 134-139
Bracket view of structure:
            10        20        30        40        50        60        70
#   123456789|123456789|123456789|123456789|123456789|123456789|123456789|12345
$ 1 GAAAACAAAUCGCUUAAUCUGAAAUCAGAGCGGGGGACCCAAUAGAACGGCUUUUUGCCGUUGGGGUGAAUCCUU=75
% 1 :::::::((:(((((::((((::::))))(((((((::((:::::((((((:::::))))))((((((::((((:

        80        90       100       110       120       130       140
#    6789|123456789|123456789|123456789|123456789|123456789|123456789|
$ 76 UUUAGGUAGGGCUAACUCUCAUAUGCCCGAAUCCGUCAGCUAACCUCGUAAGCGUUCGUGAGAGG=140
% 76 :::))))(((((:::[[[[[[:::))))))))))::):))::))))))))))))))::]]]]]]:


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2014-11-26 PKB00381.HTML