Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
SNSV1

PKB-number: PKB382
Definition: tRNA-like structure pseudoknot of RNA1
Organism: Strawberry necrotic shock virus
Abbreviation: SNSV1
RNA type: Viral tRNA-like
Keywords: Bromoviridae; Ilarvirus
EMBL number: NC_008708
Submitted by: A.P. Gultyaev (a.p.goultiaev@liacs.leidenuniv.nl)
Supported by: Sequence comparison
References: [1] Olsthoorn R.C.L. et al. (1999). EMBO J. 18:4856-4864.
[2] Chen S.C. et al. (2009). In: Feng Z. & Long M. (Eds.) "Viral Genomes: Diversity, Properties and Parameters". Nova Science Publishers, N.Y. (ISBN 978-1-60741-067-6). pp.65-83.
Stem sizes:
Loop sizes:
14 7
2 0 46
Position Paired:
3334-3341; 3368-3375
3347-3352; 3362-3367
3383-3392; 3397-3406
3355-3361; 3422-3428
Bracket view of structure:
             3340      3350      3360      3370      3380      3390
#      123456789|123456789|123456789|123456789|123456789|123456789|12345
$ 3331 UUCCAACAAGAAGGCGUCUGAGCGCAUCUUUCUCAGAUCUUGUUGAUGUUUCCAAUAAUAUCAAU=3395
% 3331 :::((((((((:::::((((((::[[[[[[[)))))))))))))):::::::((((((((((:::

        3400      3410      3420
#      6789|123456789|123456789|123456789
$ 3396 UGAUAUUAUUGAUGCCUCUAAUUUAUAGAGAUGC=3429
% 3396 :)))))))))):::::::::::::::]]]]]]]:


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2014-11-28 PKB00382.HTML