Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
BCRV1

PKB-number: PKB384
Definition: tRNA-like structure pseudoknot of RNA1
Organism: Blackberry chlorotic ringspot virus
Abbreviation: BCRV1
RNA type: Viral tRNA-like
Keywords: Bromoviridae; Ilarvirus
EMBL number: NC_011553
Submitted by: A.P. Gultyaev (a.p.goultiaev@liacs.leidenuniv.nl)
Supported by: Sequence comparison
References: [1] Olsthoorn R.C.L. et al. (1999). EMBO J. 18:4856-4864.
[2] Chen S.C. et al. (2009). In: Feng Z. & Long M. (Eds.) "Viral Genomes: Diversity, Properties and Parameters". Nova Science Publishers, N.Y. (ISBN 978-1-60741-067-6). pp.65-83.
Stem sizes:
Loop sizes:
14 6
2 1 43
Position Paired:
3384-3391; 3421-3428
3399-3404; 3414-3419
3432-3441; 3446-3455
3407-3412; 3472-3477
Bracket view of structure:
             3390      3400      3410      3420      3430      3440
#      123456789|123456789|123456789|123456789|123456789|123456789|12345
$ 3381 UAUAUACUAGGUUGGCAUUUUGAGCGCAUCUUACUCAAAUCCUAGUAUUUCCAUUAAUAUCUAAU=3445
% 3381 :::((((((((:::::::((((((::[[[[[[:)))))):)))))))):::((((((((((::::

        3450      3460      3470
#      6789|123456789|123456789|12345678
$ 3446 GAUAUUAAUGAUGCCUCUUAAUAUAAGAGAUGC=3478
% 3446 ))))))))))::::::::::::::::]]]]]]:


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2014-11-28 PKB00384.HTML