Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
PMoV3

PKB-number: PKB385
Definition: tRNA-like structure pseudoknot of RNA3
Organism: Parietaria mottle virus
Abbreviation: PMoV3
RNA type: Viral tRNA-like
Keywords: Bromoviridae; Ilarvirus
EMBL number: NC_005854
Submitted by: A.P. Gultyaev (a.p.goultiaev@liacs.leidenuniv.nl)
Supported by: Sequence comparison
References: [1] Olsthoorn R.C.L. et al. (1999). EMBO J. 18:4856-4864.
[2] Chen S.C. et al. (2009). In: Feng Z. & Long M. (Eds.) "Viral Genomes: Diversity, Properties and Parameters". Nova Science Publishers, N.Y. (ISBN 978-1-60741-067-6). pp.65-83.
Stem sizes:
Loop sizes:
17 7
2 1 45
Position Paired:
2167-2175; 2207-2215
2181-2188; 2199-2206
2220-2229; 2234-2243
2191-2197; 2261-2267
Bracket view of structure:
        2170      2180      2190      2200      2210      2220      2230
#      6789|123456789|123456789|123456789|123456789|123456789|123456789|
$ 2166 GGAUGUUCGGGUGGCUGCUUAAGCGCUUCUAUACUUAAGUACCGAAUGUUAUACCGUUAUUAUCU=2230
% 2166 :(((((((((:::::((((((((::[[[[[[[:)))))))))))))))))::::((((((((((:

             2240      2250      2260
#      123456789|123456789|123456789|12345678
$ 2231 AGUGAUAAUAACGAUGCCUAUUUCUAUGAAAUAGAAGC=2268
% 2231 :::)))))))))):::::::::::::::::]]]]]]]:


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2014-11-28 PKB00385.HTML