Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
TAMV1

PKB-number: PKB386
Definition: tRNA-like structure pseudoknot of RNA1
Organism: Tulare apple mosaic virus
Abbreviation: TAMV1
RNA type: Viral tRNA-like
Keywords: Bromoviridae; Ilarvirus
EMBL number: NC_003833
Submitted by: A.P. Gultyaev (a.p.goultiaev@liacs.leidenuniv.nl)
Supported by: Sequence comparison
References: [1] Olsthoorn R.C.L. et al. (1999). EMBO J. 18:4856-4864.
[2] Chen S.C. et al. (2009). In: Feng Z. & Long M. (Eds.) "Viral Genomes: Diversity, Properties and Parameters". Nova Science Publishers, N.Y. (ISBN 978-1-60741-067-6). pp.65-83.
Stem sizes:
Loop sizes:
15 5
7 0 65
Position Paired:
3332-3338; 3380-3386
3340-3341; 3378-3379
3342-3347; 3360-3365
3389-3395; 3402-3408
3413-3424; 3429-3440
3355-3359; 3452-3456
Bracket view of structure:
             3340      3350      3360      3370      3380      3390      3400
#      123456789|123456789|123456789|123456789|123456789|123456789|123456789|
$ 3331 AGUUCAUAUGCCCACCUUUGCUUGUCUCCGGGUGGAUGCCUCAUGGUGCUAUGAAUGCCUAUAAUUGAAA=3400
% 3331 :(((((((:((((((((:::::::[[[[[))))))::::::::::::)))))))))::(((((((:::::

             3410      3420      3430      3440      3450
#      123456789|123456789|123456789|123456789|123456789|123456789
$ 3401 UAUUAUAGAUGCCUAAUUUUCCUCUCUUGAGGAAAAUUAGAUGCCUCCAAGGGAGAAGC=3459
% 3401 :)))))))::::((((((((((((::::)))))))))))):::::::::::]]]]]:::


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2014-11-28 PKB00386.HTML