Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
SpLV3

PKB-number: PKB387
Definition: tRNA-like structure pseudoknot of RNA3
Organism: Spinach latent virus
Abbreviation: SpLV3
RNA type: Viral tRNA-like
Keywords: Bromoviridae; Ilarvirus
EMBL number: NC_003810
Submitted by: A.P. Gultyaev (a.p.goultiaev@liacs.leidenuniv.nl)
Supported by: Sequence comparison
References: [1] Olsthoorn R.C.L. et al. (1999). EMBO J. 18:4856-4864.
[2] Chen S.C. et al. (2009). In: Feng Z. & Long M. (Eds.) "Viral Genomes: Diversity, Properties and Parameters". Nova Science Publishers, N.Y. (ISBN 978-1-60741-067-6). pp.65-83.
Stem sizes:
Loop sizes:
15 4
6 0 67
Position Paired:
2183-2189; 2229-2235
2191-2192; 2227-2228
2193-2198; 2209-2214
2238-2244; 2251-2257
2262-2265; 2288-2291
2267-2274; 2280-2287
2205-2208; 2303-2306
Bracket view of structure:
             2190      2200      2210      2220      2230      2240      2250
#      123456789|123456789|123456789|123456789|123456789|123456789|123456789|
$ 2181 AAGUCCAUAUGCCCACCUUCGCUGCUCCGGGUGGAUGCUUAUACAUGCUAUGGAUGCCUACAUUUGAAAU=2250
% 2181 ::(((((((:((((((((::::::[[[[))))))::::::::::::)))))))))::(((((((::::::

             2260      2270      2280      2290      2300      2310
#      123456789|123456789|123456789|123456789|123456789|123456789|
$ 2251 AAUGUAGAUGCCUAAUACUCUCUCUCAGGGAGAGAGUUUAGAUGCCUCCAAAGGAGAUGC=2310
% 2251 )))))))::::((((:((((((((:::::)))))))))))):::::::::::]]]]::::


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2014-11-28 PKB00387.HTML