Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
CiLRV3

PKB-number: PKB388
Definition: tRNA-like structure pseudoknot of RNA3
Organism: Citrus leaf rugose virus
Abbreviation: CiLRV3
RNA type: Viral tRNA-like
Keywords: Bromoviridae; Ilarvirus
EMBL number: NC_003546
Submitted by: A.P. Gultyaev (a.p.goultiaev@liacs.leidenuniv.nl)
Supported by: Sequence comparison
References: [1] Olsthoorn R.C.L. et al. (1999). EMBO J. 18:4856-4864.
[2] Chen S.C. et al. (2009). In: Feng Z. & Long M. (Eds.) "Viral Genomes: Diversity, Properties and Parameters". Nova Science Publishers, N.Y. (ISBN 978-1-60741-067-6). pp.65-83.
Stem sizes:
Loop sizes:
15 4
6 0 63
Position Paired:
2163-2169; 2212-2218
2171-2172; 2210-2211
2173-2178; 2189-2194
2221-2227; 2232-2238
2243-2254; 2259-2270
2185-2188; 2282-2285
Bracket view of structure:
             2170      2180      2190      2200      2210      2220      2230
#      123456789|123456789|123456789|123456789|123456789|123456789|123456789|
$ 2161 AAGUUCAUAUGCCCACCUUUGCUGCUCCGGGUGGAUGCUUCGUGCAAAUGCUAUGAAUGCCUACGUAUAU=2230
% 2161 ::(((((((:((((((((::::::[[[[)))))):::::::::::::::)))))))))::(((((((:::

             2240      2250      2260      2270      2280
#      123456789|123456789|123456789|123456789|123456789|123456789
$ 2231 GUGCGUAGAUGCCUAUAUUUUCUCUCCUGAGAAAAUAUAGAUGCCUCCAAAGGAGAUGC=2289
% 2231 :)))))))::::((((((((((((::::)))))))))))):::::::::::]]]]::::


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2014-11-28 PKB00388.HTML