Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
AV-2_3

PKB-number: PKB390
Definition: tRNA-like structure pseudoknot of RNA3
Organism: Asparagus virus 2
Abbreviation: AV-2_3
RNA type: Viral tRNA-like
Keywords: Bromoviridae; Ilarvirus
EMBL number: NC_011807
Submitted by: A.P. Gultyaev (a.p.goultiaev@liacs.leidenuniv.nl)
Supported by: Sequence comparison
References: [1] Olsthoorn R.C.L. et al. (1999). EMBO J. 18:4856-4864.
[2] Chen S.C. et al. (2009). In: Feng Z. & Long M. (Eds.) "Viral Genomes: Diversity, Properties and Parameters". Nova Science Publishers, N.Y. (ISBN 978-1-60741-067-6). pp.65-83.
Stem sizes:
Loop sizes:
13 4
6 0 67
Position Paired:
2179-2185; 2225-2231
2189-2194; 2205-2210
2234-2240; 2247-2253
2258-2261; 2284-2287
2263-2270; 2276-2283
2201-2204; 2299-2302
Bracket view of structure:
      2180      2190      2200      2210      2220      2230      2240
#      89|123456789|123456789|123456789|123456789|123456789|123456789|
$ 2178 AGUCCAUAUGCCCAUCUUUGCUGCUCCGGAUGGAUGUUUAUACCCGCUAUGGAUGCCUAUUAC=2240
% 2178 :(((((((:::((((((::::::[[[[))))))::::::::::::::)))))))::(((((((

             2250      2260      2270      2280      2290      2300
#      123456789|123456789|123456789|123456789|123456789|123456789|123
$ 2241 UGAAAUGUAAUAGAUGCCUAAUACUCUCUCUCAGGGAGAGAGUUUAGAUGCCUCCAAAGGAGA=2303
% 2241 ::::::)))))))::::((((:((((((((:::::)))))))))))):::::::::::]]]]:


#      4567
$ 2304 UGCU=2307
% 2304 ::::


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2014-11-28 PKB00390.HTML