Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
EMoV3

PKB-number: PKB391
Definition: tRNA-like structure pseudoknot of RNA3
Organism: Elm mottle virus
Abbreviation: EMoV3
RNA type: Viral tRNA-like
Keywords: Bromoviridae; Ilarvirus
EMBL number: NC_003570
Submitted by: A.P. Gultyaev (a.p.goultiaev@liacs.leidenuniv.nl)
Supported by: Sequence comparison
References: [1] Olsthoorn R.C.L. et al. (1999). EMBO J. 18:4856-4864.
[2] Chen S.C. et al. (2009). In: Feng Z. & Long M. (Eds.) "Viral Genomes: Diversity, Properties and Parameters". Nova Science Publishers, N.Y. (ISBN 978-1-60741-067-6). pp.65-83.
Stem sizes:
Loop sizes:
13 4
6 0 66
Position Paired:
2189-2195; 2235-2241
2199-2204; 2215-2220
2244-2251; 2256-2263
2268-2271; 2294-2297
2273-2280; 2286-2293
2211-2214; 2308-2311
Bracket view of structure:
      2190      2200      2210      2220      2230      2240      2250      2260
#      89|123456789|123456789|123456789|123456789|123456789|123456789|123456789|
$ 2188 AGUCCAUAUGCCCAUCUUUGCUGCUCCGGAUGGAUGUUAAUACCCCCUAUGGAUGCCUAUUAUUGAAAAAUAA=2260
% 2188 :(((((((:::((((((::::::[[[[))))))::::::::::::::)))))))::((((((((::::)))))

             2270      2280      2290      2300      2310
#      123456789|123456789|123456789|123456789|123456789|12345
$ 2261 UAGAUGCCUAAUUCUCUCUCUCAGGGAGAGAGAUUAGAUGCCUCCAAGGAGAUGC=2315
% 2261 )))::::((((:((((((((:::::))))))))))))::::::::::]]]]::::


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2014-11-28 PKB00391.HTML