Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
APLPV3

PKB-number: PKB393
Definition: tRNA-like structure pseudoknot of RNA3
Organism: American plum line pattern virus
Abbreviation: APLPV3
RNA type: Viral tRNA-like
Keywords: Bromoviridae; Ilarvirus
EMBL number: NC_003453
Submitted by: A.P. Gultyaev (a.p.goultiaev@liacs.leidenuniv.nl)
Supported by: Sequence comparison
References: [1] Olsthoorn R.C.L. et al. (1999). EMBO J. 18:4856-4864.
[2] Chen S.C. et al. (2009). In: Feng Z. & Long M. (Eds.) "Viral Genomes: Diversity, Properties and Parameters". Nova Science Publishers, N.Y. (ISBN 978-1-60741-067-6). pp.65-83.
Stem sizes:
Loop sizes:
14 5
2 1 56
Position Paired:
1949-1955; 1983-1989
1957-1957; 1982-1982
1958-1963; 1972-1977
1993-1998; 2002-2007
2012-2022; 2027-2037
1966-1970; 2046-2050
Bracket view of structure:
      1950      1960      1970      1980      1990      2000      2010
#      89|123456789|123456789|123456789|123456789|123456789|123456789|
$ 1948 AGUUAACUACGAUGUCGGCCCUAGGACAUCUAUCGAGUUAACGACGAUCGCUUUGCGAUUAUG=2010
% 1948 :(((((((:(((((((::[[[[[:))))))::::)))))))):::((((((:::)))))):::

             2020      2030      2040      2050
#      123456789|123456789|123456789|123456789|123
$ 2011 CUUCAUUUUUUCUUUCGAAAAAAUGAAAUGACCCUUAGGGGCC=2053
% 2011 :(((((((((((::::)))))))))))::::::::]]]]]:::


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2014-11-28 PKB00393.HTML