Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
HJLV3

PKB-number: PKB394
Definition: tRNA-like structure pseudoknot of RNA3
Organism: Humulus japonicus latent virus
Abbreviation: HJLV3
RNA type: Viral tRNA-like
Keywords: Bromoviridae; Ilarvirus
EMBL number: NC_006066
Submitted by: A.P. Gultyaev (a.p.goultiaev@liacs.leidenuniv.nl)
Supported by: Sequence comparison
References: [1] Olsthoorn R.C.L. et al. (1999). EMBO J. 18:4856-4864.
[2] Chen S.C. et al. (2009). In: Feng Z. & Long M. (Eds.) "Viral Genomes: Diversity, Properties and Parameters". Nova Science Publishers, N.Y. (ISBN 978-1-60741-067-6). pp.65-83.
Stem sizes:
Loop sizes:
14 4
4 0 51
Position Paired:
1837-1841; 1875-1879
1843-1844; 1872-1873
1845-1846; 1869-1870
1847-1851; 1860-1864
1882-1888; 1893-1899
1904-1909; 1914-1919
1856-1859; 1931-1934
Bracket view of structure:
        1840      1850      1860      1870      1880      1890
#      6789|123456789|123456789|123456789|123456789|123456789|
$ 1836 AGACAUAUAUGCCUAUUGCCCCCUGUAGGAGUGCACUAGAUGUUGCGUGAAGAUA=1890
% 1836 :(((((:(((((((((::::[[[[)))))::::)):)):)))))::(((((((::

             1900      1910      1920      1930
#      123456789|123456789|123456789|123456789|12345678
$ 1891 UUUCUUCAUUUGCCCUACCAAAAGGUAGGAUGCCCCUUUAAGGGAGGC=1938
% 1891 ::)))))))::::((((((::::)))))):::::::::::]]]]::::


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2014-11-28 PKB00394.HTML