Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
FCiLV3

PKB-number: PKB395
Definition: tRNA-like structure pseudoknot of RNA3
Organism: Fragaria chiloensis latent virus
Abbreviation: FCiLV3
RNA type: Viral tRNA-like
Keywords: Bromoviridae; Ilarvirus
EMBL number: NC_006568
Submitted by: A.P. Gultyaev (a.p.goultiaev@liacs.leidenuniv.nl)
Supported by: Sequence comparison
References: [1] Olsthoorn R.C.L. et al. (1999). EMBO J. 18:4856-4864.
[2] Chen S.C. et al. (2009). In: Feng Z. & Long M. (Eds.) "Viral Genomes: Diversity, Properties and Parameters". Nova Science Publishers, N.Y. (ISBN 978-1-60741-067-6). pp.65-83.
Stem sizes:
Loop sizes:
16 6
1 1 56
Position Paired:
2377-2386; 2412-2421
2387-2392; 2401-2406
2424-2430; 2434-2440
2445-2452; 2460-2467
2394-2399; 2478-2483
Bracket view of structure:
        2380      2390      2400      2410      2420      2430      2440
#      6789|123456789|123456789|123456789|123456789|123456789|123456789|
$ 2376 AGUAAGUUUCUCCUAUCGCCAUCUGGAUGGGAUUUAAGAGACUUAUGCCAAACUCUUUGAGUUUG=2440
% 2376 :((((((((((((((((:[[[[[[:)))))):::::))))))))))::(((((((:::)))))))

             2450      2460      2470      2480
#      123456789|123456789|123456789|123456789|1234
$ 2441 AUGCCAAUUCAGUUUUCGUCUGAAUUGAUGCCCGAAAGGAUGGC=2484
% 2441 ::::((((((((:::::::))))))))::::::::::]]]]]]:


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2014-11-28 PKB00395.HTML