Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
PNRSV3

PKB-number: PKB396
Definition: tRNA-like structure pseudoknot of RNA3
Organism: Prunus necrotic ringspot virus
Abbreviation: PNRSV3
RNA type: Viral tRNA-like
Keywords: Bromoviridae; Ilarvirus
EMBL number: NC_004364
Submitted by: A.P. Gultyaev (a.p.goultiaev@liacs.leidenuniv.nl)
Supported by: Mutagenesis,Sequence comparison,circular dichroism
References: [1] Olsthoorn R.C.L. et al. (1999). EMBO J. 18:4856-4864.
[2] Aparicio F. et al. (2003). Virology 313:213-223.
[3] Chen S.C. et al. (2009). In: Feng Z. & Long M. (Eds.) "Viral Genomes: Diversity, Properties and Parameters". Nova Science Publishers, N.Y. (ISBN 978-1-60741-067-6). pp.65-83.
Stem sizes:
Loop sizes:
15 6
1 0 49
Position Paired:
1859-1865; 1895-1901
1866-1873; 1881-1888
1905-1908; 1913-1916
1921-1927; 1933-1939
1875-1880; 1951-1956
Bracket view of structure:
      1860      1870      1880      1890      1900      1910      1920
#      89|123456789|123456789|123456789|123456789|123456789|123456789|
$ 1858 UAGAUUUCUGAAAGUCGCUUCCCGGCUUUCAUGCUUGGAAAUCUUACCUGCGUUAGCAGAUGC=1920
% 1858 :(((((((((((((((:[[[[[[))))))))::::::))))))):::((((::::))))::::

             1930      1940      1950
#      123456789|123456789|123456789|1234567
$ 1921 CCACAACGUGAAGUUGUGGAUGCCCCGUUAGGGAAGC=1957
% 1921 (((((((:::::))))))):::::::::::]]]]]]:


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2014-11-28 PKB00396.HTML