Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
PDV3

PKB-number: PKB398
Definition: tRNA-like structure pseudoknot of RNA3
Organism: Prune dwarf virus
Abbreviation: PDV3
RNA type: Viral tRNA-like
Keywords: Bromoviridae; Ilarvirus
EMBL number: NC_008038
Submitted by: A.P. Gultyaev (a.p.goultiaev@liacs.leidenuniv.nl)
Supported by: Sequence comparison
References: [1]Olsthoorn R.C.L. et al. (1999). EMBO J. 18:4856-4864.
[2] Chen S.C. et al. (2009). In: Feng Z. & Long M. (Eds.) "Viral Genomes: Diversity, Properties and Parameters". Nova Science Publishers, N.Y. (ISBN 978-1-60741-067-6). pp.65-83.
Stem sizes:
Loop sizes:
15 6
1 1 51
Position Paired:
2028-2035; 2064-2071
2036-2037; 2061-2062
2039-2043; 2052-2056
2075-2079; 2083-2087
2093-2099; 2104-2110
2045-2050; 2123-2128
Bracket view of structure:
      2030      2040      2050      2060      2070      2080      2090
#      89|123456789|123456789|123456789|123456789|123456789|123456789|
$ 2028 GAUGAAAAUGCCCAUUGUAUCCUGAAUGGAUGACACUUUUCAUUGCCUACAAAUUUUGUACAU=2090
% 2028 ((((((((((:(((((:[[[[[[:)))))::::)):)))))))):::(((((:::))))):::

             2100      2110      2120
#      123456789|123456789|123456789|123456789
$ 2091 GCCCUCACCGUAAGGUGAGGAUGCCCCUUUAAGGGAUGC=2129
% 2091 ::(((((((::::)))))))::::::::::::]]]]]]:


Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 2014-11-28 PKB00398.HTML