What is a pseudoknot?
PseudoBase is a database of parts of RNA sequences that fold into so-called pseudoknots.
A pseudoknot is a very special way of folding.
First, the RNA string folds back upon itself, thereby forming a so-called hairpin.
The figure on the right shows this first hairpin-structure where three nucleotides CCC
pair with GGG forming a loop L1 and a stem S1.
Next, some of the nucleotides in the remaining sequence form a second coupling with nucleotids in the loop.
You can see this in the figure where nucleotides AAAA in the first loop pair with UUUU,
thereby forming a second loop L2 and a second stem S2.
This is the most basic type of pseudoknot.
A simple but lucid way to present such a pseudoknot is by "bracket-view":
acguCCCacguaAAAAGGGacguUUUUacgu
::::(((:::::[[[[)))::::]]]]::::
Here pairing is shown by associated open- and close- brackets of similar type.
Pairs of stem S1 are shown by ((())) and pairs of stem S2 by
[[[[]]]].
More complex pseudoknots require more than 2 different types of brackets. See for example the following pseudoknot:
UGGCCGGCAUGGUCCCAGCCUCCUCGCUGGCGCCGGCUGGGCAACAUUCCGAGGGGACCGUCCCCUCGGUAAUGGCGAAUGGGACCC
:(((((((::[[[[[[[{{{:[[:::::}}})))))))]]::::(((((((((((((:::))))))))):)))):::::]]]]]]]:
The secondary and tertiary structure of RNA is extremely important. Knowing this helps in understanding the function of certain RNA's and also the non-function of related (mutated) sequences. It can explain phylogenetic similarities and dissimilarities; it can explain why some parts are easily mutated and others are not; and so on.
Design of PseudoBase
Pseudobase is een database of pseudoknots. It encompasses several hundreds of similar pages, each pseudoknot that has been proven experimentally and has been published is described in a separate page. The information that we present of each pseudoknot is a.o.:
- sequence number used by PseudoBase
- definition of the RNA
- name of the organism
- RNA type
- EMBL number of the RNA
- name (and preferable email) of the submittor
- literature reference of published pseudoknot
- bracket view of nucleotides and pseudoknot structure
Apart from these pages, the database has 5 main pages to give access to the pages with pseudoknot information:
- intro: home page of PseudoBase.
- about: general information about pseudoknots and about PseudoBase.
- get by class: entry to pseudoknot pages by RNA-type.
- get by property: entry to pseudoknot pages by information;
pages are initially sorted by sequencenumber, but you can sort on various alternative criteria such as stem size,
loop size, RNA type and so on.
This is most powerful type of entry. - submit: here you can enter information of a new pseudoknot (entries are checked first before added; they should be new and they should be experimentally proven and published).
Be prepared that Pseudobase is another site with a design that is different from this website.
©