Website van Eke van Batenburg

PseudoBase

RNA has many ways to fold back upon itself. An interesting example is shown in the picture at the right. It shows many types of structures due to this process of folding; the result of this process is called the secondary structure of the RNA.
A special type of folding is the so-called pseudoknot, a tertiary structure element. See: . More about pseudoknots is told in "What is a pseudoknot".

Experimental research can determine where RNA folds back and forms such a pseudoknot. With Sacha Gultyaev and Cees Pley we started a database with information of pseudoknots that are experimentally proven and published.
We tell a bit more about it in "Design of Pseudobase", but alternatively you can go straight to the database itself PseudoBase.` Note that PseudoBase has its own structure, which is not related to the structure of this website.

GoBack GoTop GoNext

What is a pseudoknot?

PseudoBase is a database of parts of RNA sequences that fold into so-called pseudoknots.

A pseudoknot is a very special way of folding. First, the RNA string folds back upon itself, thereby forming a so-called hairpin.
The figure on the right shows this first hairpin-structure where three nucleotides CCC pair with GGG forming a loop L1 and a stem S1.
Next, some of the nucleotides in the remaining sequence form a second coupling with nucleotids in the loop. You can see this in the figure where nucleotides AAAA in the first loop pair with UUUU, thereby forming a second loop L2 and a second stem S2.
This is the most basic type of pseudoknot.

A simple but lucid way to present such a pseudoknot is by "bracket-view":

     acguCCCacguaAAAAGGGacguUUUUacgu
     ::::(((:::::[[[[)))::::]]]]::::
Here pairing is shown by associated open- and close- brackets of similar type. Pairs of stem S1 are shown by ((())) and pairs of stem S2 by [[[[]]]].
More complex pseudoknots require more than 2 different types of brackets. See for example the following pseudoknot:
 UGGCCGGCAUGGUCCCAGCCUCCUCGCUGGCGCCGGCUGGGCAACAUUCCGAGGGGACCGUCCCCUCGGUAAUGGCGAAUGGGACCC
 :(((((((::[[[[[[[{{{:[[:::::}}})))))))]]::::(((((((((((((:::))))))))):)))):::::]]]]]]]:

The secondary and tertiary structure of RNA is extremely important. Knowing this helps in understanding the function of certain RNA's and also the non-function of related (mutated) sequences. It can explain phylogenetic similarities and dissimilarities; it can explain why some parts are easily mutated and others are not; and so on.

GoBack GoTop GoNext

Design of PseudoBase

Pseudobase is een database of pseudoknots. It encompasses several hundreds of similar pages, each pseudoknot that has been proven experimentally and has been published is described in a separate page. The information that we present of each pseudoknot is a.o.:

Apart from these pages, the database has 5 main pages to give access to the pages with pseudoknot information:

If you want to use PseudoBase you could click on one of these links.
Be prepared that Pseudobase is another site with a design that is different from this website.

GoBack GoTop

©