 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
PhyMV |  |
|||
| PKB-number: | PKB8 |
| Definition: | tRNA-like structure 3'end pseudoknot of physalis mottle virus |
| Organism: | physalis mottle virus |
| Abbreviation: | PhyMV |
| RNA type: | Viral tRNA-like |
| Keywords: | tymoviruses; RNA 3'end |
| EMBL number: | Y16104 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Sequence comparison |
| References: | [1] Mans RMW, Pleij CWA, Bosch L. Eur.J.Biochem.1991, 201:303-324. |
| Stem sizes: Loop sizes: |
3 6 2 0 2 |
| Position Paired: | 6648-6650; 6659-6661 6653-6658; 6664-6669 |
| Bracket view of structure: |
6640 6650 6660 6670
# 456789|123456789|123456789|123456789|123
$ 6634 UGGGUGCAACUCCCCCCCCUUCCGUGGGUAACGGAAACCA=6673
% 6634 ::::::::::::::(((::[[[[[[)))::]]]]]]::::