 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
CYVV |  |
|||
| PKB-number: | PKB11 |
| Definition: | tRNA-like structure 3'end pseudoknot of clitoria yellow vein virus |
| Organism: | clitoria yellow vein virus |
| Abbreviation: | CYVV |
| RNA type: | Viral tRNA-like |
| Keywords: | tymoviruses; RNA 3'end |
| EMBL number: | AF035200 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Sequence comparison |
| References: | [1] Mans RMW, Pleij CWA, Bosch L. Eur.J.Biochem.1991, 201:303-324. |
| Stem sizes: Loop sizes: |
3 6 3 0 3 |
| Position Paired: | 633-635; 645-647 639-644; 651-656 |
| Bracket view of structure: |
620 630 640 650
# 89|123456789|123456789|123456789|123456789
$ 618 UGGGUGCAACCCCCCCGUCCAUCUCGAACGUCAUCGAGACCA=659
% 618 :::::::::::::::(((:::[[[[[[))):::]]]]]]:::