 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
PLRV-W |  |
|||
| PKB-number: | PKB42 |
| Definition: | ORF2/ORF3 (putative RNA-dependent RNA polymerase) ribosomal frameshift site of potato leafroll virus, Wageningen isolate |
| Organism: | potato leafroll virus |
| Abbreviation: | PLRV-W |
| RNA type: | Viral Frameshift |
| Keywords: | luteovirus; ribosomal frameshifting; RNA polymerase |
| EMBL number: | Y07496 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Sequence comparison |
| References: |
[1] van der Wilk F. et al. FEBS Lett. 1989, 245:51-56.
[2] ten Dam E.B. et al. Virus Genes 1990, 4:121-136. |
| Stem sizes: Loop sizes: |
4 3 2 1 9 |
| Position Paired: | 1676-1679; 1686-1689 1682-1684; 1699-1701 |
| Bracket view of structure: |
1670 1680 1690 1700
# 3456789|123456789|123456789|123456789|1
$ 1663 UUUAAAUGGGCGAGCGGCACCGCCCGCCAAAACAAACGG=1701
% 1663 :::::::::::::((((::[[[:)))):::::::::]]]