| Intro | |||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
| Ec_PK4 | |||||
| PKB-number: | PKB52 |
| Definition: | Pseudoknot PK4 of E.coli tmRNA |
| Organism: | E.coli |
| Abbreviation: | Ec_PK4 |
| RNA type: | tmRNA |
| Keywords: | trans-translation; peptide tagging; tmRNA |
| EMBL number: | U68074 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Sequence comparison; Structure probing |
| References: |
[1] Williams KP & Bartel DP. (1996). RNA 2:1306-1310.
[2] Felden B. et al. (1997). RNA 3:89-103. [3] Hickerson RP et al. (1998). J.Mol.Biol. 279:577-587. [4] Williams K.P. (2000). Nucleic Acids Res. 28:168. (The tmRNA Website: http://www.indiana.edu/~tmrna/). [5] Zwieb C. & Wower J. (2000). Nucleic Acids Res. 28:169-170. |
| Stem sizes: Loop sizes: |
13 6 1 0 9 |
| Position Paired: | 248-257; 274-283 259-261; 270-272 263-265; 297-299 267-269; 293-295 |
| Bracket view of structure: |
250 260 270 280 290
# 89|123456789|123456789|123456789|123456789|123456789
$ 248 GUUUGUUAGUGGCGUGUCCGUCCGCAGCUGGCAAGCGAAUGUAAAGACUGAC=299
% 248 ((((((((((:(((:[[[:[[[))):)))))))))):::::::::]]]:]]]