 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
TMV_UPD-PK3 |  |
|||
| PKB-number: | PKB55 |
| Definition: | Pseudoknot PK3 of the upstream pseudoknot domain (UPD) of the 3'-UTR of tobacco mosaic virus |
| Organism: | tobacco mosaic virus |
| Abbreviation: | TMV_UPD-PK3 |
| RNA type: | Viral 3 UTR |
| Keywords: | tobamovirus; translational regulation |
| EMBL number: | J02415 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Mutagenesis; Sequence comparison; Structure probing |
| References: |
[1] Van Belkum A. et al. (1985). Nucleic Acids Res. 13:7673-7686.
[2] Leathers V. et al. (1993). Mol. Cell. Biol. 13:5331-5347. [3] Felden B. et al. (1996). RNA 2:201-212. |
| Comment: | This is the most extensively studied representative structure from tobamoviruses. The sequence is given for the so-called "strain vulgare". |
| Stem sizes: Loop sizes: |
4 5 5 0 6 |
| Position Paired: | 6260-6263; 6274-6277 6269-6272; 6286-6289 6273-6273; 6284-6284 |
| Bracket view of structure: |
6260 6270 6280
# |123456789|123456789|123456789
$ 6260 AGUGUUUUUCCCUCCACUUAAAUCGAAGGG=6289
% 6260 ((((:::::[[[[[))))::::::]:]]]]