 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
HDV-It_ag |  |
|||
| PKB-number: | PKB76 |
| Definition: | Delta ribozyme (antigenomic) |
| Organism: | hepatitis delta virus ("Italy" variant) |
| Abbreviation: | HDV-It_ag |
| RNA type: | Ribozymes |
| Keywords: | self-cleavage; double pseudoknot |
| EMBL number: | X04451 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Mutagenesis; Sequence comparison; Structure probing |
| References: |
[1] Been M.D. & Wickham G.S. (1997). Eur. J. Biochem. 247:741-753.
[2] Lafontaine D.A. et al. (1999). Nucleic Acids Res. 27:186-187. |
| Comment: | Delta ribozyme is a catalytic self-cleaving structure, folded in both genomic and antigenomic RNAs of hepatitis delta virus. For review, see e.g.[1]. For the compilation of HDV sequences, see [2]. The sequence is shown for "Italy" variant, the numbering starts downstream of the cleavage site (positions 901/900) at nucleotide 900, thus the 3'-proximal nucleotide 89 corresponds to position 812 in the genomic RNA. |
| Stem sizes: Loop sizes: |
7 4 8 13 41 |
| Position Paired: | 1-7; 33-39 16-19; 81-84 20-22; 30-32 43-49; 68-74 54-57; 62-65 |
| Bracket view of structure: |
10 20 30 40 50 60
# 123456789|123456789|123456789|123456789|123456789|123456789|
$ 1 GGGUCGGCAUGGCAUCUCCACCUCCUCGCGGUCCGACCUGGGCAUCCGAAGGAGGACGCA=60
% 1 (((((((::::::::[[[[(((:::::::)))))))))):::(((((((::::((((:::
70 80
# 123456789|123456789|123456789
$ 61 CGUCCACUCGGAUGGCUAAGGGAGAGCCA=89
% 61 :))))::)))))))::::::]]]]:::::