 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
CcTMV_UPD-PK2 |  |
|||
| PKB-number: | PKB86 |
| Definition: | Pseudoknot PK2 of the upstream pseudoknot domain (UPD) of the 3'-UTR of the cowpea strain of tobacco mosaic virus |
| Organism: | tobacco mosaic virus |
| Abbreviation: | CcTMV_UPD-PK2 |
| RNA type: | Viral 3 UTR |
| Keywords: | tobamovirus; translational regulation |
| EMBL number: | J02413 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Sequence comparison |
| References: |
[1] van Belkum A. et al. (1985). Nucleic Acids Res. 13:7673-7686.
[2] Leathers V. et al. (1993). Mol. Cell. Biol. 13:5331-5347. |
| Comment: | This virus is also called sunhemp mosaic virus (SHMV). |
| Stem sizes: Loop sizes: |
3 5 1 0 3 |
| Position Paired: | 1626-1628; 1635-1637 1630-1634; 1641-1645 |
| Bracket view of structure: |
1630 1640
# 56789|123456789|123456
$ 1625 UAGGGGCUUACCGAAAUAAGCC=1646
% 1625 :(((:[[[[[))):::]]]]]: