Intro | |||||
About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
CGMMV_UPD-PK1 |
PKB-number: | PKB89 |
Definition: | Pseudoknot PK1 of the upstream pseudoknot domain (UPD) of the 3'-UTR of cucumber green mottle mosaic virus |
Organism: | cucumber green mottle mosaic virus |
Abbreviation: | CGMMV_UPD-PK1 |
RNA type: | Viral 3 UTR |
Keywords: | tobamovirus; translational regulation |
EMBL number: | D12505 |
Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
Supported by: | Sequence comparison |
References: |
[1] van Belkum A. et al. (1985). Nucleic Acids Res. 13:7673-7686.
[2] Leathers V. et al. (1993). Mol. Cell. Biol. 13:5331-5347. |
Stem sizes: Loop sizes: |
8 4 2 0 5 |
Position Paired: | 6235-6242; 6249-6256 6245-6248; 6262-6265 |
Bracket view of structure: |
6240 6250 6260 # 456789|123456789|123456789|123456 $ 6234 ACCUCGAAAGCUUAGUUUCGAGGGUCUUCUGAU=6266 % 6234 :((((((((::[[[[)))))))):::::]]]]: