 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
CGMMV_UPD-PK1 |  |
|||
| PKB-number: | PKB89 |
| Definition: | Pseudoknot PK1 of the upstream pseudoknot domain (UPD) of the 3'-UTR of cucumber green mottle mosaic virus |
| Organism: | cucumber green mottle mosaic virus |
| Abbreviation: | CGMMV_UPD-PK1 |
| RNA type: | Viral 3 UTR |
| Keywords: | tobamovirus; translational regulation |
| EMBL number: | D12505 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Sequence comparison |
| References: |
[1] van Belkum A. et al. (1985). Nucleic Acids Res. 13:7673-7686.
[2] Leathers V. et al. (1993). Mol. Cell. Biol. 13:5331-5347. |
| Stem sizes: Loop sizes: |
8 4 2 0 5 |
| Position Paired: | 6235-6242; 6249-6256 6245-6248; 6262-6265 |
| Bracket view of structure: |
6240 6250 6260
# 456789|123456789|123456789|123456
$ 6234 ACCUCGAAAGCUUAGUUUCGAGGGUCUUCUGAU=6266
% 6234 :((((((((::[[[[)))))))):::::]]]]: