 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
PMMV-S_UPD-PK1 |  |
|||
| PKB-number: | PKB95 |
| Definition: | Pseudoknot PK1 of the upstream pseudoknot domain (UPD) of the 3'-UTR of pepper mild mottle virus, Spanish isolate |
| Organism: | pepper mild mottle virus |
| Abbreviation: | PMMV-S_UPD-PK1 |
| RNA type: | Viral 3 UTR |
| Keywords: | tobamovirus; translational regulation |
| EMBL number: | M81413 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Sequence comparison |
| References: |
[1] Avila-Rincon M.J. et al. (1989). J. Gen. Virol. 70:3025-3031.
[2] Leathers V. et al. (1993). Mol. Cell. Biol. 13:5331-5347. |
| Comment: | The nucleotide G-6181 seems to be misprinted in the entry (M81413) of the EMBL database as A, while this is G in the original article [1], which is consistent with conserved pairing. |
| Stem sizes: Loop sizes: |
3 4 1 0 6 |
| Position Paired: | 6177-6179; 6185-6187 6181-6184; 6194-6197 |
| Bracket view of structure: |
6180 6190
# 6789|123456789|12345678
$ 6176 AGUUGGACGAACAUUAAACGUCC=6198
% 6176 :(((:[[[[)))::::::]]]]: