 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
STMV_UPD1-PK1 |  |
|||
| PKB-number: | PKB103 |
| Definition: | Pseudoknot PK1 of the upstream pseudoknot domain (UPD1) of the 3'-UTR of satellite tobacco mosaic virus |
| Organism: | satellite tobacco mosaic virus |
| Abbreviation: | STMV_UPD1-PK1 |
| RNA type: | Viral 3 UTR |
| Keywords: | tobamovirus; satellite virus; translational regulation |
| EMBL number: | M25782 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Sequence comparison |
| References: |
[1] Leathers V. et al. (1993). Mol. Cell. Biol. 13:5331-5347.
[2] Gultyaev A.P. et al. (1994). J. Gen. Virol. 75:2851-2856. [3] Felden B. et al. (1994). Nucleic Acids Res. 22:2882-2886. |
| Comment: | The relatively long 3'-UTR of STMV RNA is predicted to have two upstream pseudoknot domains (UPD). The UPD1 is located just upstream of the 3'-terminal tRNA-like structure, similar to structures in helper viruses [1-3], the UPD2 is in the 5'-proximal part of the 3'-UTR [2]. |
| Stem sizes: Loop sizes: |
3 4 1 0 8 |
| Position Paired: | 873-875; 881-883 877-880; 892-895 |
| Bracket view of structure: |
880 890
# 23456789|123456789|123456
$ 872 CGCCGACGUGGCUGUAUAAUACGUC=896
% 872 :(((:[[[[)))::::::::]]]]: