 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
SRV1_gag/pro |  |
|||
| PKB-number: | PKB107 |
| Definition: | Gag/pro ribosomal frameshift site of simian retrovirus-1 |
| Organism: | simian retrovirus-1 |
| Abbreviation: | SRV1_gag/pro |
| RNA type: | Viral Frameshift |
| Keywords: | retrovirus type D; ribosomal frameshifting; gag-pro |
| EMBL number: | M11841 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Mutagenesis; NMR; Sequence comparison; Structure probing |
| References: |
[1] ten Dam E. et al. (1990). Virus Genes 4:121-136.
[2] ten Dam E. et al. (1995). RNA 1:146-154. [3] Du Z. et al. (1997). J. Mol. Biol. 270:464-470. [4] Sung D. & Kang H. (1998). Nucleic Acids Res. 26:1369-1372. |
| Stem sizes: Loop sizes: |
6 6 1 0 12 |
| Position Paired: | 2337-2342; 2350-2355 2344-2349; 2368-2373 |
| Bracket view of structure: |
2330 2340 2350 2360 2370
# 3456789|123456789|123456789|123456789|123456789|1234
$ 2323 GGGAAACGGACUGAGGGGCCAGCCCCAGGCCCCGAAACAAGCUUAUGGGGCG=2374
% 2323 ::::::::::::::((((((:[[[[[[))))))::::::::::::]]]]]]: