 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
TMV-L_PKbulge |  |
|||
| PKB-number: | PKB139 |
| Definition: | tRNA-like structure bulge pseudoknot of the tomato strain of tobacco mosaic virus |
| Organism: | tobacco mosaic virus |
| Abbreviation: | TMV-L_PKbulge |
| RNA type: | Viral tRNA-like |
| Keywords: | tobamovirus; RNA 3'end |
| EMBL number: | X02144 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Sequence comparison |
| References: |
[1] Rietveld K. et al. (1984). EMBO J. 3:2613-2619.
[2] Mans R.M.W. et al. (1991). Eur. J. Biochem. 201:303-324. |
| Stem sizes: Loop sizes: |
6 4 4 34 9 |
| Position Paired: | 6280-6285; 6328-6333 6294-6297; 6324-6327 6303-6310; 6316-6323 6290-6293; 6343-6346 |
| Bracket view of structure: |
6280 6290 6300 6310 6320 6330 6340
# 89|123456789|123456789|123456789|123456789|123456789|123456789|1234567
$ 6278 UAGUGUCUUGGAGCGCGCGGAGUAAACAUAUAUGGUUCAUAUAUGUCCGUAGGCACGUAAAAAAAGCGAG=6347
% 6278 ::((((((::::[[[[((((:::::((((((((:::::)))))))))))))))))):::::::::]]]]: