 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
Ec_RNaseP-P4 |  |
|||
| PKB-number: | PKB149 |
| Definition: | The P4 pseudoknot of M1 RNA subunit of ribonuclease P |
| Organism: | Escherichia coli |
| Abbreviation: | Ec_RNaseP-P4 |
| RNA type: | Ribozymes |
| Keywords: | RNase P; tRNA |
| EMBL number: | K01993 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Sequence comparison; 3D-modelling |
| References: |
[1] James B.D. et al. (1988). Cell 52:19-26.
[2] Westhof E. & Altman S. (1994). Proc. Natl. Acad. Sci. USA 91:5133-5137. [3] Brown J.W. et al. (1996). Proc. Natl. Acad. Sci. USA 93:3001-3006. [4] Brown J.W. (1999). Nucleic Acids Res. 27:314. (database: http://www.mbio.ncsu.edu/RNaseP/). |
| Comment: | The numbering is given as in the EMBL database entry for the gene: the M1 precursor RNA starts from position 320. The helix P4 (66-74/353-360 in M1 RNA, 385-393/672-679 in the entry) is called P12 in [2]. The structure in conserved in many sequences; for the RNase P database, see [4]. |
| Stem sizes: Loop sizes: |
7 8 47 261 10 |
| Position Paired: | 331-337; 655-661 339-340; 379-380 342-347; 372-377 348-351; 367-370 353-357; 362-366 385-387; 677-679 389-393; 672-676 |
| Bracket view of structure: |
330 340 350 360 370 380
# |123456789|123456789|123456789|123456789|123456789|
$ 330 AGACAGUCGCCGCUUCGUCGUCGUCCUCUUCGGGGGAGACGGGCGGAGGGG=380
% 330 :(((((((:((:((((((((((:(((((::::))))))))):)))))):))
390 660 670 680
# 123456789|1234 (259) 456789|123456789|123456789|
$ 381 AGGAAAGUCCGGGC=394 UGACUGUCCACGACAGAACCCGGCUUA=680
% 381 ::::[[[:[[[[[: :)))))))::::::::::]]]]]]]]: