 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
BSMVbeta_UPD-PK2 |  |
|||
| PKB-number: | PKB152 |
| Definition: | Pseudoknot PK2 of the upstream pseudoknot domain (UPD) of the 3'UTR of RNA beta |
| Organism: | barley stripe mosaic virus |
| Abbreviation: | BSMVbeta_UPD-PK2 |
| RNA type: | Viral 3 UTR |
| Keywords: | hordeivirus; translational regulation |
| EMBL number: | X03854 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Sequence comparison |
| References: |
[1] Pleij C.W.A. et al. (1987). In: "Positive Strand RNA Viruses"
(Brinton M.A. & Rueckert P., Eds), Alan R. Liss, Inc., New York, pp 299-316.
[2] Leathers V. et al. (1993). Mol. Cell. Biol. 13:5331-5347. |
| Comment: | RNA gamma of BSMV contains similar structure. |
| Stem sizes: Loop sizes: |
3 7 1 0 3 |
| Position Paired: | 3079-3081; 3090-3092 3083-3089; 3096-3102 |
| Bracket view of structure: |
3080 3090 3100
# 89|123456789|123456789|123
$ 3078 UGGUGCCCAUCAACCAUAUGAUGGGA=3103
% 3078 :(((:[[[[[[[))):::]]]]]]]: