 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
BMV3_UPD-PK1 |  |
|||
| PKB-number: | PKB154 |
| Definition: | Pseudoknot PK1 of the upstream pseudoknot domain (UPD) of the 3'UTR of RNA3 |
| Organism: | brome mosaic virus |
| Abbreviation: | BMV3_UPD-PK1 |
| RNA type: | Viral 3 UTR |
| Keywords: | bromovirus; translational regulation; replication |
| EMBL number: | V00099 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Mutagenesis; Sequence comparison |
| References: |
[1] Pleij C.W.A. et al. (1987). In: "Positive Strand RNA Viruses"
(Brinton M.A. & Rueckert R., Eds.), Alan R. Liss, Inc., New York, pp 299-316.
[2] Lahser F.C. et al. (1993). J. Virol. 67:3295-3303. |
| Comment: | RNA1 of BMV contains similar structure. Subgenomic RNA4 is derived from RNA3, with the same 3'end. |
| Stem sizes: Loop sizes: |
5 5 1 0 2 |
| Position Paired: | 1836-1840; 1847-1851 1842-1846; 1854-1858 |
| Bracket view of structure: |
1840 1850 1860
# 56789|123456789|123456789|
$ 1835 GAGCCCCUGACUGGGUUAAAGUCACA=1860
% 1835 :(((((:[[[[[)))))::]]]]]::