 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
CoxB3 |  |
|||
| PKB-number: | PKB169 |
| Definition: | "Kissing" interaction in the 3'UTR |
| Organism: | Coxsackie B virus |
| Abbreviation: | CoxB3 |
| RNA type: | Viral 3 UTR |
| Keywords: | Picornavirus; enterovirus; kissing interaction |
| EMBL number: | M33854 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Mutagenesis; Sequence comparison; Structure probing; 3D-modelling |
| References: |
[1] Pilipenko E.V. et al. (1992). Nucleic Acids Res. 20:1739-1745.
[2] Melchers W.J.G. et al. (1997). J. Virol. 71:686-696. |
| Stem sizes: Loop sizes: |
12 6 7 1 9 5 1 0 |
| Position Paired: | 7336-7347; 7364-7375 7381-7382; 7402-7403 7384-7388; 7396-7400 7349-7354; 7390-7395 |
| Bracket view of structure: |
7340 7350 7360 7370 7380 7390
# 56789|123456789|123456789|123456789|123456789|123456789|1234
$ 7335 ACCCUACUGUGCUAACCGAACCAGAUAACGGUACAGUAGGGGUAAAUUCUCCGCAUUCGG=7394
% 7335 :((((((((((((:[[[[[[:::::::::)))))))))))):::::((:(((((:]]]]]
7400
# 56789|1234567
$ 7395 UGCGGAAAAAAAA=7407
% 7395 ]))))):))::::