 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
Bp_PK2 |  |
|||
| PKB-number: | PKB210 |
| Definition: | Pseudoknot PK2 of Bordetella pertussis tmRNA |
| Organism: | Bordetella pertussis |
| Abbreviation: | Bp_PK2 |
| RNA type: | tmRNA |
| Keywords: | trans-translation; peptide tagging; tmRNA; beta-proteobacteria |
| EMBL number: | |
| Submitted by: | A.P. Gultyaev ( gultyaev@rulsfb.LeidenUniv.nl) |
| Supported by: | Sequence comparison; 3D-modeling |
| References: |
[1]Felden B., Massire C., Westhof E., Atkins J.F. & Gesteland R.F. (2001). Nucleic Acids Res. 29:1602-1607.
[2] Williams K.P. (2000). Nucleic Acids Res. 28:168. (The tmRNA Website: http://www.indiana.edu/~tmrna). [3] Knudsen B., Wower J., Zwieb C. & Gorodkin J. (2001). Nucleic Acids Res. 29:171-172. (tmRNA database: http://psyche.uthct.edu/dbs/tmRDB/). |
| Comment: | This type of the PK2 pseudoknot structure is conserved in tmRNAs from the beta-proteobacteria [1]. |
| Stem sizes: Loop sizes: |
9 7 3 2 7 |
| Position Paired: | 133-138; 201-206 141-143; 156-158 147-153; 214-220 160-163; 196-199 164-169; 174-179 181-184; 189-192 |
| Bracket view of structure: |
140 150 160 170 180 190
# 23456789|123456789|123456789|123456789|123456789|123456789|
$ 132 CCGCUGCACUGAUCUGUCCUUGGGUCAGGCGGGGGAAGGCAACUUCCCAGGGGGCAACC=190
% 132 :((((((::(((:::[[[[[[[::))):((((((((((::::)))))):((((::::))
200 210 220
# 123456789|123456789|123456789|1
$ 191 CCGAACCGCAGCAGCGACAUUCACAAGGAAU=221
% 191 )):::)))):)))))):::::::]]]]]]]: