| Intro | |||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
| HiPV_IRES-PKII | |||||
| PKB-number: | PKB214 |
| Definition: | Pseudoknot PKII of the internal ribosomal entry site (IRES) region |
| Organism: | Himetobi P virus |
| Abbreviation: | HiPV_IRES-PKII |
| RNA type: | Viral others |
| Keywords: | Picornaviridae; Internal ribosomal entry site (IRES); Translation; Cricket paralysis-like virus |
| EMBL number: | AB017037 |
| Submitted by: | A.P. Gultyaev ( gultyaev@rulsfb.LeidenUniv.nl) |
| Supported by: | Sequence comparison |
| References: | [1] Kanamori Y. & Nakashima N. (2001). RNA 7:266-274. |
| Stem sizes: Loop sizes: |
19 5 8 6 67 |
| Position Paired: | 6286-6294; 6346-6354 6302-6311; 6331-6340 6320-6324; 6422-6426 |
| Bracket view of structure: |
6290 6300 6310 6320 6330
# 56789|123456789|123456789|123456789|123456789|1234
$ 6285 CGAAAAUGUGUGAUCUGAUUAGAAGUAAGAAAAUUCCUAGUUAUAAUAUU=6334
% 6285 :(((((((((:::::::((((((((((::::::::[[[[[::::::))))
6340 6350
# 56789|123456789|12345(64)
$ 6335 UUUAAUACUGCUACAUUUUUA=6355
% 6335 )))))):::::))))))))):
6420
# (64) |123456789
$ 6420 ACCUAGGUGC=6429
% 6420 ::]]]]]:::