| Intro | |||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
| DCV_IRES-PKII | |||||
| PKB-number: | PKB219 |
| Definition: | Pseudoknot PKII of the internal ribosomal entry site (IRES) region |
| Organism: | Drosophila C virus |
| Abbreviation: | DCV_IRES-PKII |
| RNA type: | Viral others |
| Keywords: | Picornaviridae; Internal ribosomal entry site (IRES); Translation; Cricket paralysis-like virus |
| EMBL number: | AF014388 |
| Submitted by: | A.P. Gultyaev ( gultyaev@rulsfb.LeidenUniv.nl) |
| Supported by: | Sequence comparison |
| References: | [1] Kanamori Y. & Nakashima N. (2001). RNA 7:266-274. |
| Stem sizes: Loop sizes: |
18 6 10 8 67 |
| Position Paired: | 6078-6086; 6139-6147 6093-6101; 6126-6134 6112-6117; 6215-6220 |
| Bracket view of structure: |
6080 6090 6100 6110 6120
# 789|123456789|123456789|123456789|123456789|1234
$ 6077 AGUUAAGAUGUGAUCUUGCUUCCUUAUACAAUUUUGAGAGGUUAAUAA=6124
% 6077 :(((((((((::::::(((((((((::::::::::[[[[[[:::::::
6130 6140
# 56789|123456789|12345678 (64)
$ 6125 GAAGGAAGUAGUGCUAUCUUAAUA=6148
% 6125 :)))))))))::::))))))))):
6220
# (64) 3456789|123
$ 6213 ACCCUCUCUGC=6223
% 6213 ::]]]]]]:::