 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
TrV_IRES-PKII |  |
|||
| PKB-number: | PKB225 |
| Definition: | Pseudoknot PKII of the internal ribosomal entry site (IRES) region |
| Organism: | Triatoma virus |
| Abbreviation: | TrV_IRES-PKII |
| RNA type: | Viral others |
| Keywords: | Picornaviridae; Internal ribosomal entry site (IRES); Translation; Cricket paralysis-like virus |
| EMBL number: | AF178440 |
| Submitted by: | A.P.Gultyaev ( gultyaev@rulsfb.LeidenUniv.nl) |
| Supported by: | Sequence comparison |
| References: | [1] Kanamori Y. & Nakashima N. (2001). RNA 7:266-274. |
| Stem sizes: Loop sizes: |
17 7 9 8 68 |
| Position Paired: | 5925-5933; 5984-5992 5940-5947; 5972-5979 5957-5963; 6061-6067 |
| Bracket view of structure: |
5930 5940 5950 5960 5970 5980 5990
# 456789|123456789|123456789|123456789|123456789|123456789|123456789|123(66)
$ 5924 CUUGACUAUGUGAUCUUGCUUUCGUAAUAAAAUUCUGUACAUAAAAGUCGAAAGUAUUGCUAUAGUUAAG=5993
% 5924 :(((((((((::::::((((((((:::::::::[[[[[[[::::::::))))))))::::))))))))):
6060 6070
# (66) |123456789|
$ 6060 UGUACAGAAUU=6070
% 6060 :]]]]]]]:::